View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1121_high_37 (Length: 251)
Name: NF1121_high_37
Description: NF1121
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1121_high_37 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 71; Significance: 3e-32; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 172 - 246
Target Start/End: Complemental strand, 2411261 - 2411187
Alignment:
| Q |
172 |
atgtatctatcatacatatacattaggggtaaaacagttttccgaagataactttcaaacccttcggctatgtat |
246 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2411261 |
atgtatctatcatacatatacattacgggtaaaacagttttccgaagataactttcaaacccttcggctatgtat |
2411187 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 94 - 180
Target Start/End: Complemental strand, 2412574 - 2412488
Alignment:
| Q |
94 |
cgatcaccgctatattttgtgcctaaaaggaagataattatttcaccactctgggagataattcccgaaacttttgggatgtatcta |
180 |
Q |
| |
|
|||||||| ||||||||||||| ||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||| |
|
|
| T |
2412574 |
cgatcaccactatattttgtgcataaaaggaagataattatttcaccactctagaagataattcccgaaacttttgggatgtatcta |
2412488 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University