View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1121_low_26 (Length: 352)
Name: NF1121_low_26
Description: NF1121
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1121_low_26 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 121; Significance: 6e-62; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 121; E-Value: 6e-62
Query Start/End: Original strand, 156 - 323
Target Start/End: Complemental strand, 51367315 - 51367151
Alignment:
| Q |
156 |
ttaattgcagttccaaacgaaccaatcaaccaaatcaaaatgtatattatcgatttagtttggtttgatttcacttctgaaaattgttaaaagccaaacc |
255 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51367315 |
ttaattgcagttccaaacgaaccaatcaaccaaatcaaaatgtatactatcgatttagtttggtttgatttcacttctgaaaattgttaaaagccaaacc |
51367216 |
T |
 |
| Q |
256 |
taactgatatatatttgattagtagtataaagtttaaacannnnnnngactgaaacggaatcaaactg |
323 |
Q |
| |
|
||||||||||||||||||| |||| ||||||||||||| ||||||||| ||||||||||| |
|
|
| T |
51367215 |
taactgatatatatttgat---tagtgtaaagtttaaacatttttttgactgaaactgaatcaaactg |
51367151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 9 - 58
Target Start/End: Complemental strand, 51367459 - 51367410
Alignment:
| Q |
9 |
caacaatatggtcaaaaacatttttcttcacttcaaaatagataagttaa |
58 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
51367459 |
caacaaaatggtcaaaaacatttttcttcacttcaaaacagataagttaa |
51367410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University