View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1121_low_29 (Length: 338)
Name: NF1121_low_29
Description: NF1121
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1121_low_29 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 278; Significance: 1e-155; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 278; E-Value: 1e-155
Query Start/End: Original strand, 4 - 309
Target Start/End: Original strand, 36453388 - 36453693
Alignment:
| Q |
4 |
gtgttgtagctgcgacacgaattcagcttgtgtcgcgtttatgtgatatcaggaagcttcagttcgtttgatcgtagaccattagagaggccaacgacgg |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
36453388 |
gtgttgtagctgcgacacgaattcagcttgtgtcgcgtttatgtgatatcgggaagctttagttcgtttgatcgaagaccattagagaggccaatgacgg |
36453487 |
T |
 |
| Q |
104 |
agttacaacatgctgcttcaacaagtactcaacaagtggtggcagagctcaatggatcaaatttgtatgcaacttctcgagggatagagagagaccatga |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||| |
|
|
| T |
36453488 |
agttacaacatgctgcttcaacaagtactcaacaagtggtggcagagctcaatggatcaaactcgtatgcaacttctcgagggatagagagagaccatga |
36453587 |
T |
 |
| Q |
204 |
tgcttctcttaatattggagggtcaagtggcacaaattggaatgatgtaccaaataatggggtcgatgaacctgaacctatttgggaatgggaacaacta |
303 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
36453588 |
tgcttctcttaatattggagggtcaagtggcacaaattggaatgatgtaccaaataatggggttgatgaacctgaacctatttgggaatgggaacaacta |
36453687 |
T |
 |
| Q |
304 |
aattgg |
309 |
Q |
| |
|
|||||| |
|
|
| T |
36453688 |
aattgg |
36453693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University