View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1121_low_33 (Length: 313)
Name: NF1121_low_33
Description: NF1121
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1121_low_33 |
 |  |
|
| [»] scaffold0038 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0038 (Bit Score: 69; Significance: 6e-31; HSPs: 1)
Name: scaffold0038
Description:
Target: scaffold0038; HSP #1
Raw Score: 69; E-Value: 6e-31
Query Start/End: Original strand, 28 - 116
Target Start/End: Complemental strand, 47511 - 47423
Alignment:
| Q |
28 |
ttgctattcctcgacgattgagtgcaaaaatatagtattatagaattatacttgtcatttctatggttatcccccattggtgttgtgta |
116 |
Q |
| |
|
||||||| |||||| ||||||||| |||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
47511 |
ttgctatccctcgaagattgagtggaaaaatgtagtattatagaattatacttgtcatttctatggttagcccccattggtgttgtgta |
47423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 69; Significance: 6e-31; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 69; E-Value: 6e-31
Query Start/End: Original strand, 28 - 116
Target Start/End: Complemental strand, 28247349 - 28247261
Alignment:
| Q |
28 |
ttgctattcctcgacgattgagtgcaaaaatatagtattatagaattatacttgtcatttctatggttatcccccattggtgttgtgta |
116 |
Q |
| |
|
||||||| |||||| ||||||||| |||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
28247349 |
ttgctatccctcgaagattgagtggaaaaatgtagtattatagaattatacttgtcatttctatggttagcccccattggtgttgtgta |
28247261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 1 - 96
Target Start/End: Original strand, 28192198 - 28192291
Alignment:
| Q |
1 |
tctgaattatagttttcattacatacattgctattcctcgacgattgagtgcaaaaatatagtattatagaattatacttgtcatttctatggtta |
96 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||| ||||||||||| |||||| |||||| |||| | |||||||||| |||||||||| |
|
|
| T |
28192198 |
tctgaattatagttttcattacatacattgctatcccttgacgattgagtagaaaaatgtagtatgatag--tgttacttgtcatctctatggtta |
28192291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University