View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11220_high_15 (Length: 259)

Name: NF11220_high_15
Description: NF11220
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11220_high_15
NF11220_high_15
[»] chr7 (1 HSPs)
chr7 (16-249)||(28871769-28872002)


Alignment Details
Target: chr7 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 16 - 249
Target Start/End: Complemental strand, 28872002 - 28871769
Alignment:
16 tttttcacgttgcaggtgagaattgaggtaggtgttatcagagagaaaaagcgagagcgagaatttataggatgaggagtgagaaactttctgtctctgc 115  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||| |||||||    
28872002 tttttcacgttgcaggtgagaattgaggtaggtgttatcagagagaaaaagcgagaacaagaatttataggatgaggagtgagaaactttctctctctgc 28871903  T
116 gtgttgagtgagagagaggtgaaagaaacagtttgattcagttgtggcaggtgctgcccgatactgatacgggcagctttgaattgtaaaagaggaaact 215  Q
    |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||    
28871902 gtgttgtgtgagagagaggtgaaagaaacagtttgattcagttgtggcaggtgctgcccgatactgatacgggcagctatgaattgtaaaagaggaaact 28871803  T
216 gcccgaggagatacgggcagaggagaatagggtc 249  Q
    ||||||||||||||||||||||||||||||||||    
28871802 gcccgaggagatacgggcagaggagaatagggtc 28871769  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University