View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11220_high_15 (Length: 259)
Name: NF11220_high_15
Description: NF11220
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11220_high_15 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 16 - 249
Target Start/End: Complemental strand, 28872002 - 28871769
Alignment:
| Q |
16 |
tttttcacgttgcaggtgagaattgaggtaggtgttatcagagagaaaaagcgagagcgagaatttataggatgaggagtgagaaactttctgtctctgc |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
28872002 |
tttttcacgttgcaggtgagaattgaggtaggtgttatcagagagaaaaagcgagaacaagaatttataggatgaggagtgagaaactttctctctctgc |
28871903 |
T |
 |
| Q |
116 |
gtgttgagtgagagagaggtgaaagaaacagtttgattcagttgtggcaggtgctgcccgatactgatacgggcagctttgaattgtaaaagaggaaact |
215 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
28871902 |
gtgttgtgtgagagagaggtgaaagaaacagtttgattcagttgtggcaggtgctgcccgatactgatacgggcagctatgaattgtaaaagaggaaact |
28871803 |
T |
 |
| Q |
216 |
gcccgaggagatacgggcagaggagaatagggtc |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
28871802 |
gcccgaggagatacgggcagaggagaatagggtc |
28871769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University