View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11220_high_17 (Length: 208)
Name: NF11220_high_17
Description: NF11220
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11220_high_17 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 26 - 208
Target Start/End: Original strand, 25703467 - 25703649
Alignment:
| Q |
26 |
attgggagaggttgattgcttctgatgatggcattaaccctggtgatttgttgagaggagaagaaatttgttggttcaatggagataacatgtaattagg |
125 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
25703467 |
attggaagaggttgattgcttctgatgatggcattaaccatggtgatttgttgagaggagaagaagtttgttggttcaatggagataacatgtaattagg |
25703566 |
T |
|
| Q |
126 |
agaagcattattactgctactgctgtcgccgaagtatgttcggggactcgcggctgaggcgctgctgatacggccttggtcat |
208 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||| |||| |
|
|
| T |
25703567 |
agaagcattattactgctgctgctgtcgccgaagtatgttcggggactcgcggccgaggcactgctgatacggccttgatcat |
25703649 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University