View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11220_low_17 (Length: 248)
Name: NF11220_low_17
Description: NF11220
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11220_low_17 |
 |  |
|
| [»] scaffold0148 (1 HSPs) |
 |  |
|
Alignment Details
Target: scaffold0148 (Bit Score: 231; Significance: 1e-128; HSPs: 1)
Name: scaffold0148
Description:
Target: scaffold0148; HSP #1
Raw Score: 231; E-Value: 1e-128
Query Start/End: Original strand, 18 - 248
Target Start/End: Complemental strand, 28395 - 28165
Alignment:
| Q |
18 |
ctgtgggagagctttgaaaatccaactgacacattcctacttggaatgaatatggataagaatttgagtctgactagttggaaaggtgctgatgacccaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28395 |
ctgtgggagagctttgaaaatccaactgacacattcctacttggaatgaatatggataagaatttgagtctgactagttggaaaggtgctgatgacccaa |
28296 |
T |
 |
| Q |
118 |
gcagtggggatttcacttttaagacaatggacaaccgtttcatcatcttaaaccgaagtgaaattcattgggagagcgaagagcacggaaagcatgatca |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28295 |
gcagtggggatttcacttttaagacaatggacaaccgtttcatcatcttaaaccgaagtgaaattcattgggagagcgaagagcacggaaagcatgatca |
28196 |
T |
 |
| Q |
218 |
attggacgacatcagctttgaggtttataat |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
28195 |
attggacgacatcagctttgaggtttataat |
28165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University