View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11220_low_20 (Length: 206)
Name: NF11220_low_20
Description: NF11220
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11220_low_20 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 156; Significance: 4e-83; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 156; E-Value: 4e-83
Query Start/End: Original strand, 14 - 185
Target Start/End: Complemental strand, 4196008 - 4195837
Alignment:
| Q |
14 |
agcacagacatactcccaatttcttcaggaattttcccaccaatctcattaccagccaaattcaactcattgagtttcttaagagattgaatccctaatg |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
4196008 |
agcacagacatactcccaatttcttcaggaattttcccaccaacctcattaccagccaaattcaactcattgagtttcttaagagattgaatcccttttg |
4195909 |
T |
 |
| Q |
114 |
gaagcaccccagaaagattattcttgtgaagatcaagaatcccaagctgatgaagattcacaatactctcgg |
185 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4195908 |
gaagctccccagaaagattattcttgtgaagatcaagaatcccaagctgatgaagattcacaatactctcgg |
4195837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 35; Significance: 0.00000000007; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 14 - 84
Target Start/End: Original strand, 34923398 - 34923468
Alignment:
| Q |
14 |
agcacagacatactcccaatttcttcaggaattttcccaccaatctcattaccagccaaattcaactcatt |
84 |
Q |
| |
|
|||||||||| ||||||||| || |||||||| || |||||||||||||| |||||||||||| ||||| |
|
|
| T |
34923398 |
agcacagacaaactcccaatctcatcaggaatctttccaccaatctcattgttagccaaattcaaatcatt |
34923468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University