View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11220_low_5 (Length: 497)
Name: NF11220_low_5
Description: NF11220
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11220_low_5 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 467; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 467; E-Value: 0
Query Start/End: Original strand, 1 - 487
Target Start/End: Complemental strand, 28843380 - 28842894
Alignment:
| Q |
1 |
cctgccaacacaacactacctttgattctttaacttagcatatatcagtaacttcctcagaagggtttctttatagctttacacttctaaattccaaaac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28843380 |
cctgccaacacaacactacctttgattctttaacttagcatatatcagtaacttcctcagaagggtttctttatagctttacacttctaaattccaaaac |
28843281 |
T |
|
| Q |
101 |
tcaaaaaaccataaaactcaatgtcttataacagaaacaatggttcctctgttgtggatggattcactctgagtcccctaccatatcctgttctgttgat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28843280 |
tcaaaaaaccataaaactcaatgtcttataacagaaacaatggttcctctgttgtggatggattcactctgagtcccctaccatatcctgttctgttgat |
28843181 |
T |
|
| Q |
201 |
cttagcagtgatcttcatcttccttggtacttcatggtacttttcttatgaagatgttgttgaaactgctcaagaacaatttggttggattctatttgcc |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
28843180 |
cttagcagtgatcttcatcttccttggtacttcatggtacttttcttatgaagatgttgttgaaactgctcaagaacaatttggttgggttctatttgcc |
28843081 |
T |
|
| Q |
301 |
ttaccagtggtgctgatatttatagttcgtttggtatcatcaatggaagattcaggttggttttctggtccttctgttttgaacacgcgcagcacatcct |
400 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||| |
|
|
| T |
28843080 |
ttaccagtggtgctgatatttatagttcgtttggtatcatcaatggaagattcaggttggttttctggtccttctgttttgaacaggcgcagcacaacct |
28842981 |
T |
|
| Q |
401 |
accaaagtccatctgaagtgagttctccatggggtgtggctgctttgattgttgtgttgttgattttggtgaagtttcaatcttctt |
487 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
28842980 |
accaaagtccatctgaagggagttctccatggggtgtggctgctttgattgttgtgttgttgattttggtgcagtttcaatcttctt |
28842894 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University