View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11221_high_10 (Length: 359)
Name: NF11221_high_10
Description: NF11221
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11221_high_10 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 317; Significance: 1e-179; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 317; E-Value: 1e-179
Query Start/End: Original strand, 18 - 346
Target Start/End: Original strand, 47257915 - 47258243
Alignment:
| Q |
18 |
gttgagatcactagattccaataatatacttctgctaagaaggagaaatttcacatgatgaatgcagagtttctcagcatgtgagtcccacatgatgatg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47257915 |
gttgagatcactagattccaataatatacttctgctaagaaggagaaatttcacatgatgaatgcagagtttctcagcatgtgagtcccacatgatgatg |
47258014 |
T |
|
| Q |
118 |
ggcatctatcagccactaacatttcatcagaggatgctacatcaattatcaatgagtggtaagactttctagggaaatagaatatacagaactacatttt |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47258015 |
ggcatctatcagccactaacatttcatcagaggatgctatatcaattatcaatgagtggtaagactttctagggaaatagaatatacagaactacatttt |
47258114 |
T |
|
| Q |
218 |
aaaaattgattccaacggctcaatcaattgaataagcaattatttgaatggatcgatggcgatttcattcaaatttaagcagtttaaaatagttgaatcc |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47258115 |
aaaaattgattccaacggctcaatcaattgaataagcaattatttgaatggatcgatggcaatttcattcaaatttaagcagtttaaaatagttgaatcg |
47258214 |
T |
|
| Q |
318 |
tgatctagagatttcgtcagtttgatgtc |
346 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
47258215 |
tgatctagagatttcgtcagtttgatgtc |
47258243 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University