View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11221_low_11 (Length: 327)
Name: NF11221_low_11
Description: NF11221
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11221_low_11 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 1 - 287
Target Start/End: Original strand, 45616385 - 45616674
Alignment:
| Q |
1 |
ccagcactcttatatgtcgtaaaatattgacaaataatagatggaagtatatgagatgtctatgtgttgaattttgatgcacttccttaaaatctttgaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
45616385 |
ccagcactcttatatgtcgtaaaatattgacaaataatagatggaagtatatgagatgtctatgtgttgaattttgatgcacttcattaaaatctttgaa |
45616484 |
T |
|
| Q |
101 |
agtaattggaatgaatgtatcagatttgatgtagttttacaacaatgactatatttaa---nnnnnnnnncccattttaaggctcatcacttgtaacaag |
197 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
45616485 |
agtaattggaatgaacgtatcagatttgatgtagttttacaacaatgactatatttaattttttttttttcccattttaaggctcatcacttgtaacaag |
45616584 |
T |
|
| Q |
198 |
aactcatttcataatcaatcaatcaactgatttctcagactctctctagttgaaacacttaacaaaccattcataatgcacatttagtta |
287 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45616585 |
aactcatttcataatcaatcaatcaactgatttctcagactctctctagttgaaacacttaacaaaccattcataatgcacatttagtta |
45616674 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University