View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11221_low_13 (Length: 267)
Name: NF11221_low_13
Description: NF11221
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11221_low_13 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 230; Significance: 1e-127; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 19 - 248
Target Start/End: Original strand, 5551771 - 5552000
Alignment:
| Q |
19 |
atcagagctacttttccgaaaggattcaaattttaatttcgataaaggttgggcttttccccgaaggatctatttcaacggcgacaactgtgtgatgcca |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5551771 |
atcagagctacttttccgaaaggattcaaattttaatttcgataaaggttgggcttttccccgaaggatctatttcaacggcgacaactgtgtgatgcca |
5551870 |
T |
 |
| Q |
119 |
ccacctgatgcttatccatggttgcctaatgctggttccaaacaaaaggtttccttccttgctttggtgatggcttcgttggtagccttggtacttcatg |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5551871 |
ccacctgatgcttatccatggttgcctaatgctggttccaaacaaaaggtttccttccttgctttggtgatggcttcgttggtagccttggtacttcatg |
5551970 |
T |
 |
| Q |
219 |
catattcttaatgtttggatccgtggtacg |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
5551971 |
catattcttaatgtttggatccgtggtacg |
5552000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 92; E-Value: 9e-45
Query Start/End: Original strand, 22 - 149
Target Start/End: Complemental strand, 5539075 - 5538948
Alignment:
| Q |
22 |
agagctacttttccgaaaggattcaaattttaatttcgataaaggttgggcttttccccgaaggatctatttcaacggcgacaactgtgtgatgccacca |
121 |
Q |
| |
|
||||||| |||||||||||||| | ||||| ||||||||||||||||||||||||||| ||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
5539075 |
agagctaattttccgaaaggataagagttttactttcgataaaggttgggcttttccccggaggatttatttcaatggcgacaactgtgtgatgccacca |
5538976 |
T |
 |
| Q |
122 |
cctgatgcttatccatggttgcctaatg |
149 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
5538975 |
cctgatgcttatccatggttgcctaatg |
5538948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 71; Significance: 3e-32; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 23 - 156
Target Start/End: Original strand, 5008908 - 5009044
Alignment:
| Q |
23 |
gagctacttttccgaaaggat---tcaaattttaatttcgataaaggttgggcttttccccgaaggatctatttcaacggcgacaactgtgtgatgccac |
119 |
Q |
| |
|
|||||||| |||||||||||| |||| ||| | ||| ||||| || |||||||| || ||||||||||| |||||||||||||| ||||||||||||| |
|
|
| T |
5008908 |
gagctactcttccgaaaggataaatcaactttcacttttgataagggctgggctttccctcgaaggatctacttcaacggcgacaattgtgtgatgccac |
5009007 |
T |
 |
| Q |
120 |
cacctgatgcttatccatggttgcctaatgctggttc |
156 |
Q |
| |
|
|||||||||||||||||||||| |||||| ||||||| |
|
|
| T |
5009008 |
cacctgatgcttatccatggttacctaatactggttc |
5009044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University