View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11223_high_11 (Length: 215)

Name: NF11223_high_11
Description: NF11223
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11223_high_11
NF11223_high_11
[»] chr7 (1 HSPs)
chr7 (20-201)||(7324058-7324239)
[»] chr6 (1 HSPs)
chr6 (96-196)||(27095631-27095731)


Alignment Details
Target: chr7 (Bit Score: 146; Significance: 4e-77; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 146; E-Value: 4e-77
Query Start/End: Original strand, 20 - 201
Target Start/End: Original strand, 7324058 - 7324239
Alignment:
20 taactcgttctcagggtccactccatcacctccaaaatgatggaatattcgggtagccggcaggacatgttattgttgtttggtttgacacgattctgtc 119  Q
    ||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||| |||    
7324058 taactcgttctcagggtccactccatcacctcccaaatgatggaatattcggggagccggcaggacatgttattgttgtttggtttgacacaattccgtc 7324157  T
120 ctttttgtccttaaatttctttagggatatgaattgctttcctaactatcgctttccctaggatttctgttgtttctctctg 201  Q
    ||||||||| ||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||| ||||    
7324158 ctttttgtctttagatttctttagggatatgaatttctttcctaactatcgctttccctaggatttccgttgtttctttctg 7324239  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 96 - 196
Target Start/End: Original strand, 27095631 - 27095731
Alignment:
96 tgtttggtttgacacgattctgtcctttttgtccttaaatttctttagggatatgaattgctttcctaactatcgctttccctaggatttctgttgtttc 195  Q
    ||||||||||||||| || | ||| |||||||| ||| ||||||| ||||| |||||| |||| ||||||||||| ||||| ||| |||| ||||| |||    
27095631 tgtttggtttgacacaatgccgtcttttttgtctttagatttcttgagggacatgaatagcttgcctaactatcgttttccttagaatttatgttggttc 27095730  T
196 t 196  Q
    |    
27095731 t 27095731  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University