View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11223_low_15 (Length: 215)
Name: NF11223_low_15
Description: NF11223
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11223_low_15 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 146; Significance: 4e-77; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 146; E-Value: 4e-77
Query Start/End: Original strand, 20 - 201
Target Start/End: Original strand, 7324058 - 7324239
Alignment:
| Q |
20 |
taactcgttctcagggtccactccatcacctccaaaatgatggaatattcgggtagccggcaggacatgttattgttgtttggtttgacacgattctgtc |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||| ||| |
|
|
| T |
7324058 |
taactcgttctcagggtccactccatcacctcccaaatgatggaatattcggggagccggcaggacatgttattgttgtttggtttgacacaattccgtc |
7324157 |
T |
|
| Q |
120 |
ctttttgtccttaaatttctttagggatatgaattgctttcctaactatcgctttccctaggatttctgttgtttctctctg |
201 |
Q |
| |
|
||||||||| ||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||| |||| |
|
|
| T |
7324158 |
ctttttgtctttagatttctttagggatatgaatttctttcctaactatcgctttccctaggatttccgttgtttctttctg |
7324239 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 96 - 196
Target Start/End: Original strand, 27095631 - 27095731
Alignment:
| Q |
96 |
tgtttggtttgacacgattctgtcctttttgtccttaaatttctttagggatatgaattgctttcctaactatcgctttccctaggatttctgttgtttc |
195 |
Q |
| |
|
||||||||||||||| || | ||| |||||||| ||| ||||||| ||||| |||||| |||| ||||||||||| ||||| ||| |||| ||||| ||| |
|
|
| T |
27095631 |
tgtttggtttgacacaatgccgtcttttttgtctttagatttcttgagggacatgaatagcttgcctaactatcgttttccttagaatttatgttggttc |
27095730 |
T |
|
| Q |
196 |
t |
196 |
Q |
| |
|
| |
|
|
| T |
27095731 |
t |
27095731 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University