View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11224_high_5 (Length: 298)
Name: NF11224_high_5
Description: NF11224
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11224_high_5 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 278; Significance: 1e-155; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 278; E-Value: 1e-155
Query Start/End: Original strand, 1 - 282
Target Start/End: Original strand, 45175727 - 45176008
Alignment:
| Q |
1 |
tcagagaaagtgtttggatgagcccccaactggctatatccacgtccgagcaagaaggggtcaggccactgatagccacagccttgctgaaagggtatag |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
45175727 |
tcagagaaagtgtttggatgagcccccaactggctatatccacgtccgagcaagaaggggtcaggccactgatagccacagccttgctgaaagggtacag |
45175826 |
T |
 |
| Q |
101 |
tacattactagtattttcatttcatgtggggtccacttgtatactacaattccaaaactgtcccttttagttatcttcatgtctcattctgaatattgca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45175827 |
tacattactagtattttcatttcatgtggggtccacttgtatactacaattccaaaactgtcccttttagttatcttcatgtctcattctgaatattgca |
45175926 |
T |
 |
| Q |
201 |
aattgaattaaattggatgaattatattcaggtaagaagagagaaaataagtgaaaggatgaagaagttgcagcaacttgtg |
282 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45175927 |
aattgaattaaattggatgaattatattcaggtaagaagagagaaaataagtgaaaggatgaagaagttgcagcaacttgtg |
45176008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 53; Significance: 2e-21; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 26 - 98
Target Start/End: Original strand, 40311436 - 40311508
Alignment:
| Q |
26 |
ccaactggctatatccacgtccgagcaagaaggggtcaggccactgatagccacagccttgctgaaagggtat |
98 |
Q |
| |
|
|||||||| |||||||| ||| ||||||||||||||||||| || |||||||||||||||||||||||||||| |
|
|
| T |
40311436 |
ccaactggttatatccatgtcagagcaagaaggggtcaggcaacagatagccacagccttgctgaaagggtat |
40311508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 227 - 282
Target Start/End: Original strand, 40311699 - 40311754
Alignment:
| Q |
227 |
ttcaggtaagaagagagaaaataagtgaaaggatgaagaagttgcagcaacttgtg |
282 |
Q |
| |
|
||||||| ||||||||||||||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
40311699 |
ttcaggtgagaagagagaaaataagtgaaagaatgaagatattgcagcaacttgtg |
40311754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 38 - 98
Target Start/End: Complemental strand, 16270448 - 16270388
Alignment:
| Q |
38 |
atccacgtccgagcaagaaggggtcaggccactgatagccacagccttgctgaaagggtat |
98 |
Q |
| |
|
||||| |||||||| ||||||||||| || ||||||||||| || ||||| ||||| |||| |
|
|
| T |
16270448 |
atccatgtccgagctagaaggggtcaagctactgatagccatagtcttgcagaaagagtat |
16270388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University