View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11224_high_6 (Length: 272)
Name: NF11224_high_6
Description: NF11224
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11224_high_6 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 76; Significance: 3e-35; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 9 - 88
Target Start/End: Complemental strand, 43764028 - 43763949
Alignment:
| Q |
9 |
agaagcagagaggattatactatacgcacgcttccatgactctgatctgttcagaagtgtgcctgtgatatttcttcctt |
88 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43764028 |
agaagcatagaggattatactatacgcacgcttccatgactctgatctgttcagaagtgtgcctgtgatatttcttcctt |
43763949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 182 - 256
Target Start/End: Complemental strand, 43763846 - 43763772
Alignment:
| Q |
182 |
attgatttggatttagctggacctgaatactcactgctaatttcctccacacgctcacctcctattgtactccct |
256 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43763846 |
attgatttggatttagctggacctgaatactcactgctaatttcctccacacgctcacctcctattgtactccct |
43763772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University