View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11224_high_8 (Length: 257)
Name: NF11224_high_8
Description: NF11224
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11224_high_8 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 18 - 240
Target Start/End: Complemental strand, 7263057 - 7262836
Alignment:
| Q |
18 |
aaatttataatctttttattattctaacattgcccttttgnnnnnnnnagcgtgtgttccgtaattacgatccaattcttcgtcctcaagagaaggcggt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7263057 |
aaatttataatctttttattattctaacattgcccttttgttttttttagcgtgtgttccgtaattacgatccaattcttcgtcctcaagagaaggcggt |
7262958 |
T |
 |
| Q |
118 |
ggaatatgttcgtgctcttaatgcagtgaagttggataaggtcatatttgtcacccgtgnnnnnnnnattgtgaatatgattttgtaggataggatttgt |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
7262957 |
ggaatatgttcgtgctcttaatgcagtgaagttggataaggtcatatttgtcacccgtg-tttttttattgtgaatatgattttgtaggataggatttgt |
7262859 |
T |
 |
| Q |
218 |
actatgtttgctattgatattaa |
240 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
7262858 |
actatgtttgctattgatattaa |
7262836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University