View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11224_low_11 (Length: 241)
Name: NF11224_low_11
Description: NF11224
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11224_low_11 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 71; Significance: 3e-32; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 165 - 239
Target Start/End: Complemental strand, 45175401 - 45175327
Alignment:
| Q |
165 |
aacagtgatatgatggagatggaaacagaaaccattaatattattacatgagattgagggttagtattgtctctg |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
45175401 |
aacagtgatatgatggagatggaaacagaaaccattaatattattacatgagattgagggttagtattgtttctg |
45175327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 98 - 136
Target Start/End: Complemental strand, 45175469 - 45175431
Alignment:
| Q |
98 |
cattaaacatatctctaattctgtcataggaattatata |
136 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45175469 |
cattaaacatatctctaattctgtcataggaattatata |
45175431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University