View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11224_low_11 (Length: 241)

Name: NF11224_low_11
Description: NF11224
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11224_low_11
NF11224_low_11
[»] chr3 (2 HSPs)
chr3 (165-239)||(45175327-45175401)
chr3 (98-136)||(45175431-45175469)


Alignment Details
Target: chr3 (Bit Score: 71; Significance: 3e-32; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 165 - 239
Target Start/End: Complemental strand, 45175401 - 45175327
Alignment:
165 aacagtgatatgatggagatggaaacagaaaccattaatattattacatgagattgagggttagtattgtctctg 239  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
45175401 aacagtgatatgatggagatggaaacagaaaccattaatattattacatgagattgagggttagtattgtttctg 45175327  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 98 - 136
Target Start/End: Complemental strand, 45175469 - 45175431
Alignment:
98 cattaaacatatctctaattctgtcataggaattatata 136  Q
    |||||||||||||||||||||||||||||||||||||||    
45175469 cattaaacatatctctaattctgtcataggaattatata 45175431  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University