View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11225_high_30 (Length: 220)
Name: NF11225_high_30
Description: NF11225
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11225_high_30 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 100; Significance: 1e-49; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 18 - 146
Target Start/End: Original strand, 26413798 - 26413926
Alignment:
| Q |
18 |
gcagagaagaggtcgaaacaactcaagatgtgctaagagattacataaatgtaatgccacatagtatgagtgagacatgaannnnnnncatagtaatctc |
117 |
Q |
| |
|
|||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
26413798 |
gcagagaagaggtcaaaacaactcaagatctgctaagagattacataaatgtaatgccacatagtatgagtgagacatgaatttttttcatagtaatctc |
26413897 |
T |
 |
| Q |
118 |
atagagtggattcatttggatgtgaaatg |
146 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
26413898 |
atagagtggattcatttggatgtgaaatg |
26413926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 143 - 211
Target Start/End: Original strand, 26413957 - 26414025
Alignment:
| Q |
143 |
aatggaaagaatattgggcattggcttgccatcatctttggaattggaggaacaaagagaagcatcaag |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
26413957 |
aatggaaagaatattgggcattggcttgccatcatctttggaattggaggaacagagagaagcatcaag |
26414025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 162 - 203
Target Start/End: Original strand, 1536556 - 1536597
Alignment:
| Q |
162 |
attggcttgccatcatctttggaattggaggaacaaagagaa |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1536556 |
attggcttgccatcatctttggaattggaggaacaaagagaa |
1536597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 106 - 146
Target Start/End: Original strand, 1536475 - 1536515
Alignment:
| Q |
106 |
catagtaatctcatagagtggattcatttggatgtgaaatg |
146 |
Q |
| |
|
|||||||||||||| ||||||||||||||| |||| ||||| |
|
|
| T |
1536475 |
catagtaatctcattgagtggattcatttgaatgtaaaatg |
1536515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University