View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11225_low_12 (Length: 397)
Name: NF11225_low_12
Description: NF11225
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11225_low_12 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 356; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 356; E-Value: 0
Query Start/End: Original strand, 1 - 386
Target Start/End: Complemental strand, 48861675 - 48861293
Alignment:
| Q |
1 |
taccaagtaagcctttatcagtactaaaagaagaaccatagcaattgttgtcttcaattctaaaagatggagaccggaatctgttgctggttacatgagg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
48861675 |
taccaagtaagcctttatcagtactaaaagaagaaccatagcaattgttgtcttcaattctaaaagatggagaacggaatctgttgctggttacatgagg |
48861576 |
T |
 |
| Q |
101 |
accctgctgcaaaagggtgggtgagggtactaatagcaaccttggaggaagctccaaacacttgtcactactgggattagtgaagggcacaagtgcattg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48861575 |
accctgctgcaaaagggtgggtgagggtactaatagcaaccttggaggaagctccaaacacttgtcactactgggattagtgaagggcacaagtgcattg |
48861476 |
T |
 |
| Q |
201 |
caaagccttggctttcctggttcttgttcccaaagaaatggtactgaacctgaggtttgcagtggtggagtcaccgtccccgttctctctggggattcca |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48861475 |
caaagccttggctttcctggttcttgttcccaaagaaatggtactgaacctgaggtttgaagtggtggagtcaccgtccccgttctctctggggattcca |
48861376 |
T |
 |
| Q |
301 |
tttgcatttgaattttcattgctgctggtgagacagagaacaaagggagcgttggtatgctgctgctctcttgctctgcctatgct |
386 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||| |||| |
|
|
| T |
48861375 |
tttgcatttgaattttcattgctgctggtgagacagagaacaaagggagccttggtatgc---tgctctcttgctctgcctttgct |
48861293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University