View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11225_low_32 (Length: 212)
Name: NF11225_low_32
Description: NF11225
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11225_low_32 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 119; Significance: 6e-61; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 119; E-Value: 6e-61
Query Start/End: Original strand, 12 - 165
Target Start/End: Complemental strand, 14438713 - 14438559
Alignment:
| Q |
12 |
gagcacagacaatttttagggtatgagattttatatcagacgaaacagcgttgttttaggttaggtttaaatgagaaattgcaaaaaa-tttattattac |
110 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||| | ||||||||| |
|
|
| T |
14438713 |
gagcacacacaatttttagggtatgagattttatatcagacgaagcagcgttgttttaggttaggtttaaatgatgaattgcaaaaaactgtattattac |
14438614 |
T |
|
| Q |
111 |
tgtatatattgaaggtggtaggaatagacataagtgtttggtaaaattaataatg |
165 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
14438613 |
tgtatagattgaaggtggtaggaatagacataagtgtttagtaaaattaataatg |
14438559 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University