View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11226_high_11 (Length: 333)
Name: NF11226_high_11
Description: NF11226
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11226_high_11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 126; Significance: 6e-65; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 126; E-Value: 6e-65
Query Start/End: Original strand, 116 - 317
Target Start/End: Original strand, 34034944 - 34035145
Alignment:
| Q |
116 |
caaagccaccaccttgcttatcttctttactttcgagtgatgccaagagaactacatatgtaagagcgtaatttatagtttcttttctcagttgttgttt |
215 |
Q |
| |
|
||||||||| ||||| |||||||||||||||||| ||||||||||||||| | |||||| | ||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
34034944 |
caaagccactaccttacttatcttctttactttctagtgatgccaagagagcaacatatattagagcataatttatagtttcttttctcagttgttgttt |
34035043 |
T |
 |
| Q |
216 |
taaaattagcatcctatacaattgtaaataactatttctcttagcgatagttaatttatattttttatggtgcctttttgtgcagcatctcacggtacct |
315 |
Q |
| |
|
||||||||||||||||||||| ||||||||| | |||||||||| ||||||||||||||||| |||||||||||||| ||| | ||||| || |||||| |
|
|
| T |
34035044 |
taaaattagcatcctatacaactgtaaataattgtttctcttagtaatagttaatttatatttattatggtgccttttggtgtaccatcttacagtacct |
34035143 |
T |
 |
| Q |
316 |
tt |
317 |
Q |
| |
|
|| |
|
|
| T |
34035144 |
tt |
34035145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 80; Significance: 2e-37; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 6 - 85
Target Start/End: Original strand, 34888983 - 34889062
Alignment:
| Q |
6 |
agaaagcaaccaatgtgcggacattttggcgaaatggcaagcataccaatgtacggattatatggcgaaaatgggaggaa |
85 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34888983 |
agaaagcaaccaatgtgcggacattttggcgaaatggcaagcataccaatgtacggattatatggcgaaaatgggaggaa |
34889062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University