View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11227_high_16 (Length: 242)
Name: NF11227_high_16
Description: NF11227
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11227_high_16 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 144; Significance: 8e-76; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 144; E-Value: 8e-76
Query Start/End: Original strand, 29 - 242
Target Start/End: Complemental strand, 34113089 - 34112879
Alignment:
| Q |
29 |
aaattgcccatgaatggagctacaattatagtaagacactccaattatagtttttgaaattatggttgcagtagcattgcgattggatcaagatttgtat |
128 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34113089 |
aaattgcccacgaatggagctacaattatagtaagacacttcaattatagtttttgaaattatggttgcagtagcattgcgattggatcaagatttgtat |
34112990 |
T |
 |
| Q |
129 |
attatnnnnnnnnnnnnnnnnnncggtttctttatcatctatgtagcacggatcaacacttttaattgaagatgtatggccggtgtttgacacattacat |
228 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34112989 |
atta---caaaaaaaaaaaaaaacggtttctttatcatctatgtagcacggatcaacacttttaattgaagatgtatggccggtgtttgacacattacat |
34112893 |
T |
 |
| Q |
229 |
ttaattattctatt |
242 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
34112892 |
ttaattattctatt |
34112879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University