View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11227_high_18 (Length: 239)
Name: NF11227_high_18
Description: NF11227
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11227_high_18 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 65 - 223
Target Start/End: Complemental strand, 24999431 - 24999270
Alignment:
| Q |
65 |
tggtggttgaaacatacataa---gagtagagtttaacaatagtattcaaacctctccaccccttccattggcacaaccttcctcttcttccatcatttt |
161 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||| |
|
|
| T |
24999431 |
tggtggttgaaacatacataataagagtagagtttaacaatagtattcaaacctctccaccccttccattggcacaacatttctcttcttccatcatttt |
24999332 |
T |
|
| Q |
162 |
gtttgacttcggttaggatatgtatttaggccaccattggagggtggcctctatctctcttt |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24999331 |
gtttgacttcggttaggatatgtatttaggccaccattggagggtggcctctatctctcttt |
24999270 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University