View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11227_low_13 (Length: 279)
Name: NF11227_low_13
Description: NF11227
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11227_low_13 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 248; Significance: 1e-138; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 14 - 265
Target Start/End: Original strand, 46041946 - 46042197
Alignment:
| Q |
14 |
agactgacttcgaaaaaccttctttgggatacttggaggtttagggatgttgcgttgtttttctgtttggttattagggttaggaggtaatgaattagtt |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46041946 |
agactgacttcgaaaaaccttctttgggatacttggaggtttagggatgttgcattgtttttctgtttggttattagggttaggaggtaatgaattagtt |
46042045 |
T |
 |
| Q |
114 |
tcagggacactttcttcatcttcatcttcgtctattctataatggacttgttcaggaaaaacggtggcaattgtgcggttcgcgctttgtagctcctttg |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46042046 |
tcagggacactttcttcatcttcatcttcgtctattctataatggacttgttcaggaaaaacggtggcaattgtgcggttcgcgctttgtagctcctttg |
46042145 |
T |
 |
| Q |
214 |
atagatgatcatatttctctgctaatgctctatatgctctaaaggcttcttc |
265 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46042146 |
atagatgatcatatttctctgctaatgctctatatgctctaaaggcttcttc |
46042197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 211 - 266
Target Start/End: Complemental strand, 27974253 - 27974198
Alignment:
| Q |
211 |
ttgatagatgatcatatttctctgctaatgctctatatgctctaaaggcttcttct |
266 |
Q |
| |
|
|||||| |||||||||| | || ||||| |||||||||||| |||||||||||||| |
|
|
| T |
27974253 |
ttgataaatgatcatatctttcggctaaggctctatatgctttaaaggcttcttct |
27974198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University