View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11227_low_17 (Length: 242)

Name: NF11227_low_17
Description: NF11227
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11227_low_17
NF11227_low_17
[»] chr7 (1 HSPs)
chr7 (29-242)||(34112879-34113089)


Alignment Details
Target: chr7 (Bit Score: 144; Significance: 8e-76; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 144; E-Value: 8e-76
Query Start/End: Original strand, 29 - 242
Target Start/End: Complemental strand, 34113089 - 34112879
Alignment:
29 aaattgcccatgaatggagctacaattatagtaagacactccaattatagtttttgaaattatggttgcagtagcattgcgattggatcaagatttgtat 128  Q
    |||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34113089 aaattgcccacgaatggagctacaattatagtaagacacttcaattatagtttttgaaattatggttgcagtagcattgcgattggatcaagatttgtat 34112990  T
129 attatnnnnnnnnnnnnnnnnnncggtttctttatcatctatgtagcacggatcaacacttttaattgaagatgtatggccggtgtttgacacattacat 228  Q
    ||||                   |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34112989 atta---caaaaaaaaaaaaaaacggtttctttatcatctatgtagcacggatcaacacttttaattgaagatgtatggccggtgtttgacacattacat 34112893  T
229 ttaattattctatt 242  Q
    ||||||||||||||    
34112892 ttaattattctatt 34112879  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University