View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11227_low_20 (Length: 237)
Name: NF11227_low_20
Description: NF11227
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11227_low_20 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 17 - 220
Target Start/End: Complemental strand, 55286825 - 55286622
Alignment:
| Q |
17 |
agacacagacatcagacgcatactaacactgacacgttgaaaccagtaattatttcgaaaattgatataattgaatgtgatcacatgtgttggtcagtgt |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
55286825 |
agacacagacatcagacgcatactaacactgacaccttgaaaccagtaattatttcgaaaattgacataattgaatgtgatcacatgtgttggtcagtgt |
55286726 |
T |
 |
| Q |
117 |
cgtgttggtgttggatattgacatgtgtcaaacatcgtacacgttttctaccagaagtattgatgatagagagattttaaatatagtaatatgtaatgat |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
55286725 |
cgtgttggtgttggatattgacatgtgtcaaacatcgtacacgctttctaccagaagtattgatgctagagagattttaaatatagtaatatgtaatgat |
55286626 |
T |
 |
| Q |
217 |
aaag |
220 |
Q |
| |
|
|||| |
|
|
| T |
55286625 |
aaag |
55286622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University