View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11228_high_18 (Length: 228)
Name: NF11228_high_18
Description: NF11228
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11228_high_18 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 210
Target Start/End: Complemental strand, 44031 - 43822
Alignment:
| Q |
1 |
gagaaagaagggaatcgttctcgcttcgaagaaatcttctcgaaccgcttctgaaggtttactcgctctcgctcaaaaccaccacaaaaccgctctcatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44031 |
gagaaagaagggaatcgttctcgcttcgaagaaatcttctcgaaccgcttctgaaggtttactcgctctcgctcaaaaccaccacaaaaccgctctcatt |
43932 |
T |
 |
| Q |
101 |
gaactcaattgcgagactgatttcgttgccagaaatgacatctttcaacatttggcacgttctctcgctaatcaagctttgttgttggacagcaactctt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43931 |
gaactcaattgcgagactgatttcgttgccagaaatgacatctttcaacatttggcacgttctctcgctaatcaagctttgttgttggacagcaactctt |
43832 |
T |
 |
| Q |
201 |
cctttcactt |
210 |
Q |
| |
|
|||||||||| |
|
|
| T |
43831 |
cctttcactt |
43822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University