View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11228_low_14 (Length: 279)
Name: NF11228_low_14
Description: NF11228
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11228_low_14 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 18 - 262
Target Start/End: Original strand, 37538432 - 37538673
Alignment:
| Q |
18 |
aagtcctacactctctccaatgattccatccactgagtttctagctccttcctctcctatagcacaacattcacaggatgtatcggcctcatcaactgag |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
37538432 |
aagtcctacactctctccaatgattccatccaccgagtttctagctccttcctctcctatagcacaacattcacaggatgtatcggcctcatcaaccgag |
37538531 |
T |
|
| Q |
118 |
aaaggaaatcttcaagccttcatttcaatagtgttgagtttagtagtggtgtttatggccttcttctaaggatgagaaaaatccgactcaactcaaccat |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37538532 |
aaaggaaatcttcaagccttcatttcaatagtgttgagtttagtagtggtgtttatggc---cttctaaggatgagaaaaatccgactcaactcaaccat |
37538628 |
T |
|
| Q |
218 |
ttttattgagtctattttgtgttgaaatttgtttttggtgtgtct |
262 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37538629 |
ttttattgagtctattttgtgttgaaatttgtttttggtgtgtct |
37538673 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University