View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11228_low_17 (Length: 230)
Name: NF11228_low_17
Description: NF11228
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11228_low_17 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 129; Significance: 6e-67; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 129; E-Value: 6e-67
Query Start/End: Original strand, 19 - 174
Target Start/End: Original strand, 37303072 - 37303227
Alignment:
| Q |
19 |
gaacttacttaaaagataaatcaagttgctattatttatgtttctannnnnnnnnatccaaaacgaatttatgtttatatgttaaattaggtcaaactta |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37303072 |
gaacttacttaaaagataaatcaagttgctattatttatgtttctatttttttttatccaaaacgaatttatgtttatatgttaaattaggtcaaactta |
37303171 |
T |
 |
| Q |
119 |
ctaaaacttacttaatatatcttagtttattataccttttcaaaaaatgaattaac |
174 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37303172 |
ctaaaacttacttaatatatcttagtttattataccttttcaaaaaatgaattaac |
37303227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University