View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11228_low_8 (Length: 393)
Name: NF11228_low_8
Description: NF11228
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11228_low_8 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 213; Significance: 1e-117; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 151 - 375
Target Start/End: Complemental strand, 12006561 - 12006337
Alignment:
| Q |
151 |
aaaaataataataaatacccttcggttatagtatgcctggtacaaaaaggtcatcgaaattccagaattgtcgacgcctttctttcacagatattgctgc |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
12006561 |
aaaaataataataaatacccttcggttatagtatgcctggtacaaaaaggtcatcgaaattccacaattgtcgacgcctttctttcacagatattgctgc |
12006462 |
T |
 |
| Q |
251 |
actaaccgaggtaaaaggctgttctgaaatctcatttttccactagtatggtcaaaaattgttcctcattatatcaacacattcaatcttagtagcctta |
350 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
12006461 |
actaaccgaggtaaaaggctgttctgaaatctcatttttccactagtatggtcaaaaattgttcctcattatatcaacacattcaatcttagtagcctca |
12006362 |
T |
 |
| Q |
351 |
ttggctgcaacatttctattacagg |
375 |
Q |
| |
|
||||||||||||||||||| ||||| |
|
|
| T |
12006361 |
ttggctgcaacatttctatcacagg |
12006337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 8 - 109
Target Start/End: Complemental strand, 12006673 - 12006571
Alignment:
| Q |
8 |
cagcacagataccggacaaaacttactgtgtcaaattaactttcttttgaacgttcttctgtattatatgcaaggaagcg-aggttcaaagaacaagcag |
106 |
Q |
| |
|
|||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||| |
|
|
| T |
12006673 |
cagcactgatatcggacaaaacttactgtgtcaaattaactttcttttgaacgttcttctgtattatatgcaaggaagcgaaggttcgaagaacaagcag |
12006574 |
T |
 |
| Q |
107 |
cgc |
109 |
Q |
| |
|
||| |
|
|
| T |
12006573 |
cgc |
12006571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University