View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11229_low_6 (Length: 346)
Name: NF11229_low_6
Description: NF11229
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11229_low_6 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 85; Significance: 2e-40; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 253 - 337
Target Start/End: Complemental strand, 347824 - 347740
Alignment:
| Q |
253 |
tggaaacccatctgaatctcaatcttgaaaaatttgtaacatggattccccttatgccttgatacttgatcatcatttttcttct |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
347824 |
tggaaacccatctgaatctcaatcttgaaaaatttgtaacatggattccccttatgccttgatacttgatcatcatttttcttct |
347740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 118 - 166
Target Start/End: Complemental strand, 347937 - 347889
Alignment:
| Q |
118 |
tcaaaacatcggatcctatgttttagccaataacaaccattgtgttaaa |
166 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
347937 |
tcaaaacatcggatcctatgttttagccaataacaaccattgtgttaaa |
347889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 172 - 210
Target Start/End: Complemental strand, 347861 - 347823
Alignment:
| Q |
172 |
aaagtcgagcatattcacttatgtggtagactaactatg |
210 |
Q |
| |
|
|||||||||||| || ||||||||||||||||||||||| |
|
|
| T |
347861 |
aaagtcgagcatcttaacttatgtggtagactaactatg |
347823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 32; Significance: 0.000000008; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 209 - 260
Target Start/End: Original strand, 33317497 - 33317548
Alignment:
| Q |
209 |
tgttcgttggcattgtttgatggcacctaacctttaggcaaacctggaaacc |
260 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| | |||||| |||||||| |
|
|
| T |
33317497 |
tgtttgttggcattgtttgatggcacctaacctctttgcaaacatggaaacc |
33317548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University