View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11229_low_6 (Length: 346)

Name: NF11229_low_6
Description: NF11229
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11229_low_6
NF11229_low_6
[»] chr3 (3 HSPs)
chr3 (253-337)||(347740-347824)
chr3 (118-166)||(347889-347937)
chr3 (172-210)||(347823-347861)
[»] chr1 (1 HSPs)
chr1 (209-260)||(33317497-33317548)


Alignment Details
Target: chr3 (Bit Score: 85; Significance: 2e-40; HSPs: 3)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 253 - 337
Target Start/End: Complemental strand, 347824 - 347740
Alignment:
253 tggaaacccatctgaatctcaatcttgaaaaatttgtaacatggattccccttatgccttgatacttgatcatcatttttcttct 337  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
347824 tggaaacccatctgaatctcaatcttgaaaaatttgtaacatggattccccttatgccttgatacttgatcatcatttttcttct 347740  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 118 - 166
Target Start/End: Complemental strand, 347937 - 347889
Alignment:
118 tcaaaacatcggatcctatgttttagccaataacaaccattgtgttaaa 166  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||    
347937 tcaaaacatcggatcctatgttttagccaataacaaccattgtgttaaa 347889  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 172 - 210
Target Start/End: Complemental strand, 347861 - 347823
Alignment:
172 aaagtcgagcatattcacttatgtggtagactaactatg 210  Q
    |||||||||||| || |||||||||||||||||||||||    
347861 aaagtcgagcatcttaacttatgtggtagactaactatg 347823  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 32; Significance: 0.000000008; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 209 - 260
Target Start/End: Original strand, 33317497 - 33317548
Alignment:
209 tgttcgttggcattgtttgatggcacctaacctttaggcaaacctggaaacc 260  Q
    |||| |||||||||||||||||||||||||||| |  |||||| ||||||||    
33317497 tgtttgttggcattgtttgatggcacctaacctctttgcaaacatggaaacc 33317548  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University