View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11229_low_8 (Length: 303)
Name: NF11229_low_8
Description: NF11229
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11229_low_8 |
 | |
|
| [»] scaffold1300 (3 HSPs) |
| | |
|
Alignment Details
Target: chr3 (Bit Score: 129; Significance: 9e-67; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 129; E-Value: 9e-67
Query Start/End: Original strand, 123 - 290
Target Start/End: Complemental strand, 8521120 - 8520955
Alignment:
| Q |
123 |
tggtgtgatggggtagtagttctgttgaggtgtactgagattttattcgcaggttctttcagccatgtgttggctgtatgtgttttgatcaaggatattg |
222 |
Q |
| |
|
||||| |||||||||||||||||||||||| || |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
8521120 |
tggtgcgatggggtagtagttctgttgaggcgtcctgagatttttttcgcaggttctttcagccatgtgttggctgtatgtgttttgatcaagaatattg |
8521021 |
T |
|
| Q |
223 |
ttttggtatgttttgcggctgttcactacgtactagttttgttgtttggggtgtgctcttgtttgtct |
290 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||| |||||||||||| |||||||||||||||| |
|
|
| T |
8521020 |
ttttggtatgttttgcggttgttcactacgtactagtgttgttgtttggg--gtgctcttgtttgtct |
8520955 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1300 (Bit Score: 120; Significance: 2e-61; HSPs: 3)
Name: scaffold1300
Description:
Target: scaffold1300; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 27 - 166
Target Start/End: Complemental strand, 540 - 401
Alignment:
| Q |
27 |
aagatttttgttcggctttgtgtgttcaggtggacctgttcagccccatgggaggtgtcctatgcctcataattattggagtgtcttagtgtcttttggt |
126 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
540 |
aagatttttgttcggctttgtgtgttcaggtagacctgttcagccccaggggaggtgtcctatgcctcataattattggagtgtcttagtgtcttttggt |
441 |
T |
|
| Q |
127 |
gtgatggggtagtagttctgttgaggtgtactgagatttt |
166 |
Q |
| |
|
| |||||||||||||||||||||||| || |||||||||| |
|
|
| T |
440 |
gcgatggggtagtagttctgttgaggcgtcctgagatttt |
401 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1300; HSP #2
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 220 - 290
Target Start/End: Complemental strand, 326 - 258
Alignment:
| Q |
220 |
ttgttttggtatgttttgcggctgttcactacgtactagttttgttgtttggggtgtgctcttgtttgtct |
290 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||| |
|
|
| T |
326 |
ttgttttggtatgttttgcggctgttcactacgtactagtgttgttgtttggg--gtgctcttgtttgtct |
258 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1300; HSP #3
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 221 - 275
Target Start/End: Complemental strand, 394 - 340
Alignment:
| Q |
221 |
tgttttggtatgttttgcggctgttcactacgtactagttttgttgtttggggtg |
275 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
394 |
tgttttggtatgttttgcggctgttcactacgtactagtgttgttgtttggggtg |
340 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 45; Significance: 1e-16; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 91 - 265
Target Start/End: Original strand, 10980974 - 10981150
Alignment:
| Q |
91 |
cctcataattattggagtgtcttagtgtcttttggtgtgatggggtagtagttctgttgaggtgtactgagattttattcgca-ggttctttcagccatg |
189 |
Q |
| |
|
|||||||||| | | ||||| ||||||||||| ||| ||| |||||||||||||||| ||||| || |||||| || | |||| ||| || ||| |
|
|
| T |
10980974 |
cctcataattgtcgaagtgttttagtgtctttgagtgcgatagggtagtagttctgttaaggtggcttgggattttttttttaaggttgttttagttatg |
10981073 |
T |
|
| Q |
190 |
tgttggctgtatgtgttttgatcaaggatattgtt-ttggtatgttttgcggctgttcactacgtactagttttgtt |
265 |
Q |
| |
|
|||||| ||| |||||| || |||||||||||||| ||||| ||||||| ||||||||||||| ||||||| ||||| |
|
|
| T |
10981074 |
tgttggatgtgtgtgttatggtcaaggatattgttattggtttgttttggggctgttcactacatactagtgttgtt |
10981150 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University