View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11231_high_2 (Length: 278)
Name: NF11231_high_2
Description: NF11231
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11231_high_2 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 19 - 278
Target Start/End: Original strand, 27633653 - 27633916
Alignment:
| Q |
19 |
gacattgcgtgtcatcatgttttagatgatattgagcctcaaatgcatgcgtgttcatacatttaatgacactcattcgcgattatataataaa-tgtgc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
27633653 |
gacattgcgtgtcatcatgttttagatgatattgagcctcaaatgcatgcatgttcatacatttaatgacactcattcgcgattatataataaaatgtgc |
27633752 |
T |
|
| Q |
118 |
aagacctcttttcttcttatgtatgccctgccattctttatttcaactatca---ctctttcgttgcttatgtctgcgcgtttgagaaaatgcaatttct |
214 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
27633753 |
aagaccttttttcttcttatgtatgccctgccattctttatttcaactatcatcactctttcgttgcttatgtatgcgcgtttgagaaaatgcaatttct |
27633852 |
T |
|
| Q |
215 |
aggtcatgggagtcatatatgtccaagtttacatgtctgctcgaaacctaggatttttgtaccc |
278 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27633853 |
aggtcatgggagtcatatatgtccaagtttacatgtctgctcgaaacctaggatttttgtaccc |
27633916 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University