View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11233_high_14 (Length: 375)
Name: NF11233_high_14
Description: NF11233
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11233_high_14 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 233; Significance: 1e-129; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 1 - 233
Target Start/End: Original strand, 41785751 - 41785983
Alignment:
| Q |
1 |
tcatgagcaatgtgtctaaaatgctttgtgaggttcagtttgcgaaggattggataaagaaaatgaacgtcgaaatgaaacaattgaaggaaaatgtgga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41785751 |
tcatgagcaatgtgtctaaaatgctttgtgaggttcagtttgcgaaggattggataaagaaaatgaacgtcgaaatgaaacaattgaaggaaaatgtgga |
41785850 |
T |
|
| Q |
101 |
ttgtcttacaacgctactgagcgaaaaagaagagcaggaattgttgttaagagacaaagtatggaatttagaagccacagtgagcaaagaaggaggagag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41785851 |
ttgtcttacaacgctactgagcgaaaaagaagagcaggaattgttgttaagagacaaagtatggaatttagaagccacagtgagcaaagaaggaggagag |
41785950 |
T |
|
| Q |
201 |
aaattgaacttgacaaatgcagtgagccagctt |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
41785951 |
aaattgaacttgacaaatgcagtgagccagctt |
41785983 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 276 - 353
Target Start/End: Original strand, 41786026 - 41786103
Alignment:
| Q |
276 |
gatgaggatttggatagccttggggagaagaagagggaagcaataagacagctttgtttggttgttgagtttcatcgc |
353 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41786026 |
gatgaggatttggatagccttggggagaagaagagggaagcaataagacagctttgtttggttgttgagtttcatcgc |
41786103 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University