View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11233_high_21 (Length: 250)
Name: NF11233_high_21
Description: NF11233
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11233_high_21 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 17 - 234
Target Start/End: Original strand, 38877411 - 38877628
Alignment:
| Q |
17 |
catcagaggtctgctctgattaaccttcacagcgcctaaacaaattgattatgttttggtccttaaatgatgttcaatattactttgatatccaaagtcc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38877411 |
catcagaggtctgctctgattaaccttcacagcgcctaaacaaattgattatgttttggtccttaaatgatgttcaatattactttgatatccaaagtcc |
38877510 |
T |
 |
| Q |
117 |
taccagatattaataactctttgatattactcttctcaggttatctttgccgatggaaccttcattgatgggagtactagtgagctttcatgcgatggac |
216 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38877511 |
taccagatattaataactctttaatattactcttctcaggttatctttgccgatggaaccttcattgatgggagtactagtgagctttcatgcgatggac |
38877610 |
T |
 |
| Q |
217 |
ctcttagagagccatttg |
234 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
38877611 |
ctcttagagagccatttg |
38877628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University