View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11233_high_23 (Length: 237)
Name: NF11233_high_23
Description: NF11233
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11233_high_23 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 40146810 - 40147031
Alignment:
| Q |
1 |
cttcaagtagtctttagtttactctttagaatactattatgctccttggagttctgcggccaatacaagtgcactgttttacaaatggaatatagagttg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||| |
|
|
| T |
40146810 |
cttcaagtagtctttagtttactctttagaatactattatgctccttggagttctgcggccaatacaagtgcactgttttacaaatggaatatggtgttg |
40146909 |
T |
 |
| Q |
101 |
tttttgtatctttcttgtactatatataattgctgcacataacacttcaatttgtctgctgaaattaacagggtttggcaggagttgcctgtgcttgtca |
200 |
Q |
| |
|
|||||||||| ||||||||||||||||||||| || |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40146910 |
tttttgtatcattcttgtactatatataattgttgaacataacacttcaaattgtctgctgaaattaacagggtttggcaggagttgcctgtgcttgtca |
40147009 |
T |
 |
| Q |
201 |
ttgtcagcatgcttgcttattt |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
40147010 |
ttgtcagcatgcttgcttattt |
40147031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University