View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11233_high_3 (Length: 587)
Name: NF11233_high_3
Description: NF11233
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11233_high_3 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 534; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 534; E-Value: 0
Query Start/End: Original strand, 18 - 575
Target Start/End: Original strand, 40383432 - 40383989
Alignment:
| Q |
18 |
caattgagttaccgtttccattaccaccattagttcctgagactaatttccctcttgagatactggcactgatggcgtcttttaacgacattttaggtcc |
117 |
Q |
| |
|
|||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
40383432 |
caattgagttaccgttgccattaccaccgttagttcctgagactaatttccctcttgagatactcgcactgatggcgtcttttaacgacattttaggtcc |
40383531 |
T |
|
| Q |
118 |
gttaacggcagttacagatgctggtttatactttaactgccatgacttgttgaactctacaaggctttttgttcctccgggagtctcttcaagctcacgg |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||| |
|
|
| T |
40383532 |
gttaacggcagttacagatgctggtttatactttaactgccatgacttgttgaactctacaaggctttttgttcctccgggattttcttcaagctcacgg |
40383631 |
T |
|
| Q |
218 |
attagatccagtgcgaattctgtcttgttctcgttttctggtatgggatggccgaattcatggaaaaaactagggaggttcgccggagagccgctgtaga |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40383632 |
attagatccagtgcgaattctgtcttgttctcgttttctggtatgggatggccgaattcatggaaaaaactagggaggttcgccggagagccgctgtaga |
40383731 |
T |
|
| Q |
318 |
cggtttgtccatgggaaaggaagatcaaacggtctaacaaaccaaggattctgtagcttggttgatgaacggtcatcatgacgatgctaccgctctgagc |
417 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40383732 |
cggtttgtccatgggaaaggaagatcaaacggtctaacaaaccgaggattctgtagcttggttgatgaacggtcatcatgacgatgctaccgctctgagc |
40383831 |
T |
|
| Q |
418 |
aattctctgcaaaaccttcaccaccatgtaagcgcttgtagagtcaagtccagaggttggttcatccaagaacaaaatgattggatcgtggatgatgtct |
517 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40383832 |
aattctctgcaaaaccttcaccaccatgtaagcgcttgtagagtcaagtccagaggttggttcatccaagaacaaaatgattggatcgtggatgatgtct |
40383931 |
T |
|
| Q |
518 |
gtgccgatggagacacggcggcgttctccaccggaaacaccacggtgaccttcatctc |
575 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40383932 |
gtgccgatggagacacggcggcgttctccaccggaaacaccacggtgaccttcatctc |
40383989 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University