View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11233_low_14 (Length: 375)

Name: NF11233_low_14
Description: NF11233
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11233_low_14
NF11233_low_14
[»] chr8 (2 HSPs)
chr8 (1-233)||(41785751-41785983)
chr8 (276-353)||(41786026-41786103)


Alignment Details
Target: chr8 (Bit Score: 233; Significance: 1e-129; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 1 - 233
Target Start/End: Original strand, 41785751 - 41785983
Alignment:
1 tcatgagcaatgtgtctaaaatgctttgtgaggttcagtttgcgaaggattggataaagaaaatgaacgtcgaaatgaaacaattgaaggaaaatgtgga 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41785751 tcatgagcaatgtgtctaaaatgctttgtgaggttcagtttgcgaaggattggataaagaaaatgaacgtcgaaatgaaacaattgaaggaaaatgtgga 41785850  T
101 ttgtcttacaacgctactgagcgaaaaagaagagcaggaattgttgttaagagacaaagtatggaatttagaagccacagtgagcaaagaaggaggagag 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41785851 ttgtcttacaacgctactgagcgaaaaagaagagcaggaattgttgttaagagacaaagtatggaatttagaagccacagtgagcaaagaaggaggagag 41785950  T
201 aaattgaacttgacaaatgcagtgagccagctt 233  Q
    |||||||||||||||||||||||||||||||||    
41785951 aaattgaacttgacaaatgcagtgagccagctt 41785983  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 276 - 353
Target Start/End: Original strand, 41786026 - 41786103
Alignment:
276 gatgaggatttggatagccttggggagaagaagagggaagcaataagacagctttgtttggttgttgagtttcatcgc 353  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41786026 gatgaggatttggatagccttggggagaagaagagggaagcaataagacagctttgtttggttgttgagtttcatcgc 41786103  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University