View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11233_low_22 (Length: 243)

Name: NF11233_low_22
Description: NF11233
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11233_low_22
NF11233_low_22
[»] chr2 (1 HSPs)
chr2 (1-227)||(3489342-3489565)
[»] chr4 (1 HSPs)
chr4 (100-197)||(35549654-35549751)


Alignment Details
Target: chr2 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 1 - 227
Target Start/End: Complemental strand, 3489565 - 3489342
Alignment:
1 attaaaaaatgcaacatgttattagtaattttttacaaaatcatttatgatctttccatagggtagttaaaaaatcatgactttgcaaaccaaatttaca 100  Q
    |||||||||||||||||||||||||||||||   ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3489565 attaaaaaatgcaacatgttattagtaattt---acaaaatcatttatgatctttccatagggtagttaaaaaatcatgactttgcaaaccaaatttaca 3489469  T
101 taccagttggaaatggtgcaaatgatttagcacagctagcttttacaagctccaaattttcagaaataaccacagaaccatcagcagcaataccccaata 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3489468 taccagttggaaatggtgcaaatgatttagcacagctagcttttacaagctccaaattttcagaaataaccacagaaccatcagcagcaataccccaata 3489369  T
201 gaggccaatatggccatcagaacccta 227  Q
    |||||||||||||||||||||||||||    
3489368 gaggccaatatggccatcagaacccta 3489342  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 58; Significance: 2e-24; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 100 - 197
Target Start/End: Complemental strand, 35549751 - 35549654
Alignment:
100 ataccagttggaaatggtgcaaatgatttagcacagctagcttttacaagctccaaattttcagaaataaccacagaaccatcagcagcaatacccca 197  Q
    |||||||| || |||||||||||||| |||| |||||| ||||| | |||||||||||| ||||||||||| |||||||||||||| |||||||||||    
35549751 ataccagtagggaatggtgcaaatgacttagaacagcttgctttaataagctccaaattctcagaaataacaacagaaccatcagctgcaatacccca 35549654  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University