View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11233_low_22 (Length: 243)
Name: NF11233_low_22
Description: NF11233
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11233_low_22 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 1 - 227
Target Start/End: Complemental strand, 3489565 - 3489342
Alignment:
| Q |
1 |
attaaaaaatgcaacatgttattagtaattttttacaaaatcatttatgatctttccatagggtagttaaaaaatcatgactttgcaaaccaaatttaca |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3489565 |
attaaaaaatgcaacatgttattagtaattt---acaaaatcatttatgatctttccatagggtagttaaaaaatcatgactttgcaaaccaaatttaca |
3489469 |
T |
 |
| Q |
101 |
taccagttggaaatggtgcaaatgatttagcacagctagcttttacaagctccaaattttcagaaataaccacagaaccatcagcagcaataccccaata |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3489468 |
taccagttggaaatggtgcaaatgatttagcacagctagcttttacaagctccaaattttcagaaataaccacagaaccatcagcagcaataccccaata |
3489369 |
T |
 |
| Q |
201 |
gaggccaatatggccatcagaacccta |
227 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
3489368 |
gaggccaatatggccatcagaacccta |
3489342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 58; Significance: 2e-24; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 100 - 197
Target Start/End: Complemental strand, 35549751 - 35549654
Alignment:
| Q |
100 |
ataccagttggaaatggtgcaaatgatttagcacagctagcttttacaagctccaaattttcagaaataaccacagaaccatcagcagcaatacccca |
197 |
Q |
| |
|
|||||||| || |||||||||||||| |||| |||||| ||||| | |||||||||||| ||||||||||| |||||||||||||| ||||||||||| |
|
|
| T |
35549751 |
ataccagtagggaatggtgcaaatgacttagaacagcttgctttaataagctccaaattctcagaaataacaacagaaccatcagctgcaatacccca |
35549654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University