View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11233_low_27 (Length: 230)

Name: NF11233_low_27
Description: NF11233
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11233_low_27
NF11233_low_27
[»] chr7 (1 HSPs)
chr7 (64-230)||(42302499-42302665)
[»] chr5 (1 HSPs)
chr5 (64-230)||(2368719-2368885)
[»] chr2 (1 HSPs)
chr2 (101-199)||(1343348-1343446)
[»] chr6 (2 HSPs)
chr6 (144-230)||(14208188-14208274)
chr6 (64-102)||(14208143-14208181)


Alignment Details
Target: chr7 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 64 - 230
Target Start/End: Original strand, 42302499 - 42302665
Alignment:
64 tataatagtgatgatgatgaattgaactaactgttgggatgatttggtacggaaagtctgtacgccgagagaaagacacgcaatccgtttgtccttgaat 163  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||    
42302499 tataatagtgatgatgatgaattgaactaactgttgggatgatttggtacggaaagtctgtacgccgagagaaagacacgcaatccatttgtccttgaat 42302598  T
164 tgcatctccgtgcaggggagggcgaagagagcgatttaggtgcagttggcagcagagagtagtttgt 230  Q
    |||||||||||| || ||||||||||||||||||||  |||| ||||||||||||||||||||||||    
42302599 tgcatctccgtgtagaggagggcgaagagagcgattccggtgaagttggcagcagagagtagtttgt 42302665  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 115; Significance: 1e-58; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 115; E-Value: 1e-58
Query Start/End: Original strand, 64 - 230
Target Start/End: Original strand, 2368719 - 2368885
Alignment:
64 tataatagtgatgatgatgaattgaactaactgttgggatgatttggtacggaaagtctgtacgccgagagaaagacacgcaatccgtttgtccttgaat 163  Q
    |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||| ||||||||    
2368719 tataatagtgatgatgataaattgaactaactgttgggatgatttggtacggaaagtctgtacgccgaaagaaagacacgcaatccatttgcccttgaat 2368818  T
164 tgcatctccgtgcaggggagggcgaagagagcgatttaggtgcagttggcagcagagagtagtttgt 230  Q
    ||||||||||||||   |||||||||||||||||||  | || |||||| || ||||||||||||||    
2368819 tgcatctccgtgcaaatgagggcgaagagagcgattccgatgaagttggaagtagagagtagtttgt 2368885  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 71; Significance: 3e-32; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 101 - 199
Target Start/End: Original strand, 1343348 - 1343446
Alignment:
101 gatgatttggtacggaaagtctgtacgccgagagaaagacacgcaatccgtttgtccttgaattgcatctccgtgcaggggagggcgaagagagcgatt 199  Q
    |||||||||||||||||||||||| ||||||||||||| || ||||||| ||||||||||||||||||||||| || | ||||||||||||||||||||    
1343348 gatgatttggtacggaaagtctgttcgccgagagaaaggcaggcaatccatttgtccttgaattgcatctccgcgcggaggagggcgaagagagcgatt 1343446  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 47; Significance: 6e-18; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 144 - 230
Target Start/End: Original strand, 14208188 - 14208274
Alignment:
144 caatccgtttgtccttgaattgcatctccgtgcaggggagggcgaagagagcgatttaggtgcagttggcagcagagagtagtttgt 230  Q
    |||||| | |||||||||||||||||||||||||| ||||||||||||||||||||   ||| |||||||| |  ||||||||||||    
14208188 caatccatctgtccttgaattgcatctccgtgcagaggagggcgaagagagcgattccagtgaagttggcaacgaagagtagtttgt 14208274  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 64 - 102
Target Start/End: Original strand, 14208143 - 14208181
Alignment:
64 tataatagtgatgatgatgaattgaactaactgttggga 102  Q
    |||||||||||||||||||||||||||||||| ||||||    
14208143 tataatagtgatgatgatgaattgaactaactcttggga 14208181  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University