View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11234_high_13 (Length: 231)
Name: NF11234_high_13
Description: NF11234
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11234_high_13 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 184; Significance: 1e-99; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 20 - 215
Target Start/End: Original strand, 49042859 - 49043053
Alignment:
| Q |
20 |
ttacaacaaatcttatgaaaacacatggtggttgaaatgcaataatctaaattttgttggcagtatttatttgatttgatgacaattatcttgtttattt |
119 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
49042859 |
ttacaactaatcttatgaaaacacatggtggttgaaatgcaataatctaaattttgttggcagtatttatt-gatttgatgacaattatcttgtttattt |
49042957 |
T |
 |
| Q |
120 |
gtttaaatttatatcggctgatcaagtgatatgagtatcggcataaacctgaccccatacaaactatgtaacagggaagtccgaacaagcgtctct |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49042958 |
gtttaaatttatatcggctgatcaagtgatatgagtatcggcataaacctgaccccatacaaactatgtaacagggaagtccgaacaagcgtctct |
49043053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 88 - 191
Target Start/End: Original strand, 49047397 - 49047500
Alignment:
| Q |
88 |
atttgatttgatgacaattatcttgtttatttgtttaaatttatatcggctgatcaagtgatatgagtatcggcataaacctgaccccatacaaactatg |
187 |
Q |
| |
|
||||||||||||||||||| |||||||| ||| |||||| |||||| | ||||||||||||| ||||||| ||||||| |||||||||||||||||||| |
|
|
| T |
49047397 |
atttgatttgatgacaattctcttgtttgtttctttaaacttatattgtttgatcaagtgatacgagtatcagcataaatctgaccccatacaaactatg |
49047496 |
T |
 |
| Q |
188 |
taac |
191 |
Q |
| |
|
|||| |
|
|
| T |
49047497 |
taac |
49047500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University