View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11234_high_16 (Length: 219)

Name: NF11234_high_16
Description: NF11234
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11234_high_16
NF11234_high_16
[»] chr7 (1 HSPs)
chr7 (42-210)||(25957165-25957333)


Alignment Details
Target: chr7 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 42 - 210
Target Start/End: Complemental strand, 25957333 - 25957165
Alignment:
42 ctgtacttgtactaatatgactgactgttccgacataattgcagttctgccgaaagatttgatccaagggaacattcttggtttagaatagcaaacatga 141  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
25957333 ctgtacttgtactaatatgactgactgttccgacataattgcagttctgccgaaagatttgatccaagggaacattcttggtttagaatagcaaacatga 25957234  T
142 ataccagacggggctgtcactcaatggccactctaaatgaaaaattgtgagttcaacatctctgcttct 210  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||    
25957233 ataccagacggggctgtcactcaatggccactctaaatgaaaaattgtgagttcaacatctttgcttct 25957165  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University