View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11234_low_11 (Length: 251)
Name: NF11234_low_11
Description: NF11234
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11234_low_11 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 155; Significance: 2e-82; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 75 - 233
Target Start/End: Complemental strand, 35443146 - 35442988
Alignment:
| Q |
75 |
tgtatatttgtatagattgcatttcttctcgtggttttatgcagttggaaattttgtatagaatgaggttttattttttgattagtaaatagtagatagg |
174 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35443146 |
tgtatatttgtatagattgcatttcttctcgtggttttatgcagttggaaattttgtatagaatgaggttttattttttgattagtaaatagtagatagg |
35443047 |
T |
 |
| Q |
175 |
gtttgtttggttacaaaatgctaaaaatacatatatttatgtaaaataagtggttaaat |
233 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
35443046 |
gtttgtttggttacaaaatgctaaaaatacatatatttatttaaaataagtggttaaat |
35442988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 1 - 77
Target Start/End: Complemental strand, 35443282 - 35443205
Alignment:
| Q |
1 |
tcattgttgatttagaatagaattttgcgaaaataaacaaaggaatcacctttgttctttacctt-ttttatgtttgt |
77 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
35443282 |
tcattgttgatttagaatagaattttgcgaaaataaacaaaggaatcacctttgttctttacctttttttatgtttgt |
35443205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 199 - 228
Target Start/End: Original strand, 16780329 - 16780358
Alignment:
| Q |
199 |
aaatacatatatttatgtaaaataagtggt |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
16780329 |
aaatacatatatttatgtaaaataagtggt |
16780358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University