View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11234_low_15 (Length: 229)
Name: NF11234_low_15
Description: NF11234
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11234_low_15 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 15 - 211
Target Start/End: Complemental strand, 5426872 - 5426676
Alignment:
| Q |
15 |
cagagatagtaatattaaagtgtatcaaaagttcttatttctcaatccctctttacttcaccatcgactcccacttcaacttcaaaaatctcacttcaaa |
114 |
Q |
| |
|
||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5426872 |
cagagctagaaatattaaagtgtatcaaaagttcttatttctcaatccctctttacttcaccatcgactcccacttcaacttcaaaaatctcacttcaaa |
5426773 |
T |
|
| Q |
115 |
tttcaaatccaaaacaaaaccccaacgcagattcctcgattcatcatggaaagacttcaacgaatgttcgcaggtgcaggtggagccctaggtcatc |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5426772 |
tttcaaatccaaaacaaaaccccaacgcagattcctcgattcatcatggaaaggcttcaacgaatgttcgcaggtgcaggtggagccctaggtcatc |
5426676 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 160 - 200
Target Start/End: Complemental strand, 6086163 - 6086123
Alignment:
| Q |
160 |
atggaaagacttcaacgaatgttcgcaggtgcaggtggagc |
200 |
Q |
| |
|
||||||||||||||| ||||||| || |||||||||||||| |
|
|
| T |
6086163 |
atggaaagacttcaaagaatgtttgcgggtgcaggtggagc |
6086123 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University