View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11234_low_17 (Length: 219)
Name: NF11234_low_17
Description: NF11234
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11234_low_17 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 42 - 210
Target Start/End: Complemental strand, 25957333 - 25957165
Alignment:
| Q |
42 |
ctgtacttgtactaatatgactgactgttccgacataattgcagttctgccgaaagatttgatccaagggaacattcttggtttagaatagcaaacatga |
141 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25957333 |
ctgtacttgtactaatatgactgactgttccgacataattgcagttctgccgaaagatttgatccaagggaacattcttggtttagaatagcaaacatga |
25957234 |
T |
|
| Q |
142 |
ataccagacggggctgtcactcaatggccactctaaatgaaaaattgtgagttcaacatctctgcttct |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
25957233 |
ataccagacggggctgtcactcaatggccactctaaatgaaaaattgtgagttcaacatctttgcttct |
25957165 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University