View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11234_low_3 (Length: 393)
Name: NF11234_low_3
Description: NF11234
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11234_low_3 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 169; Significance: 2e-90; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 169; E-Value: 2e-90
Query Start/End: Original strand, 115 - 308
Target Start/End: Original strand, 42679306 - 42679501
Alignment:
| Q |
115 |
ctaacgaacacgattttctttaaccttaccacctacgcgttagtgatgggaaattcctaggaataatatgtccagcaacaccaataggtcttgaacacat |
214 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
42679306 |
ctaacgaacgcgattttctttaaccttaccacctaagcattagtgatgggaaattcctaggaataatatgtccagcaacaccaataggttttgaacacat |
42679405 |
T |
 |
| Q |
215 |
ctttatgaatt--tatatcgggatagtaacacgcgatattttctgcttcaggaatatgtacagccaccgactatatagcgtcccttgatcaaatgt |
308 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42679406 |
ctttatgaatttatatatcgggatagtaacacgcgatattttctgcttcaggaatatgtacagccaccgactatatagcgtcccttgatcaaatgt |
42679501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 329 - 391
Target Start/End: Original strand, 42679519 - 42679581
Alignment:
| Q |
329 |
ctataacctttcacgcaacaacnnnnnnnnatacattctatacaattctttcttctctctcga |
391 |
Q |
| |
|
||||||||||||||||||| || |||||||||||||||||||||||||| |||||| |
|
|
| T |
42679519 |
ctataacctttcacgcaaccacttttttttatacattctatacaattctttcttctttctcga |
42679581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University