View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11234_low_5 (Length: 324)

Name: NF11234_low_5
Description: NF11234
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11234_low_5
NF11234_low_5
[»] chr6 (1 HSPs)
chr6 (14-308)||(30456186-30456477)


Alignment Details
Target: chr6 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 14 - 308
Target Start/End: Original strand, 30456186 - 30456477
Alignment:
Q  14 agacacaagaggtggtggatcgaatcaaagttct-gcgtggcaatggagtttggatagattgaagatagagacttgtttgttttacgtacgaatggtgtt 112  Q
    |||| |||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||    |||||||||    
T  30456186 agacgcaagaggtggtggatcaaatcaaagttctagcgtggcaatggagtttggatagattgaagatagagacttgtttattttacg----aatggtgtt 30456281  T
Q  113 ggagtccgcgtttttgtttgcgtggctaatccggattatcgttccttggctgttttagagagctatcagttgtagggtgctcaggttgtgtttggttgcg 212  Q
    ||| ||||| |||||||||||||||||||||| || ||||||||||||| ||| |||||||||| |||| ||||||||||||||||||||||||||||||    
T  30456282 ggaatccgcatttttgtttgcgtggctaatccagaatatcgttccttgggtgtgttagagagctgtcagctgtagggtgctcaggttgtgtttggttgcg 30456381  T
Q  213 gttagacaggtcggctgagggagctggtgcaggggtacagttgctgcgctgatgggttgctggttgttggtttgagtgtggtggaaaggcagtttt 308  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  30456382 gttagacaggtcggctgagggagctggtgcaggggtacagttgctgcgctgatgggttgctggttgttggtttgagtgtggtggaaaggcagtttt 30456477  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University