View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11235_high_4 (Length: 541)
Name: NF11235_high_4
Description: NF11235
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11235_high_4 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 397; Significance: 0; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 397; E-Value: 0
Query Start/End: Original strand, 116 - 532
Target Start/End: Original strand, 25495246 - 25495662
Alignment:
| Q |
116 |
ccagtctcgtgatcgcatttgcagcatgtcggctaatttaaccgccgcatcaaggtcatttcctctaatccactcttggagtggttgttgacctagttgc |
215 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25495246 |
ccagtctcgtgatcgcaattgcagcatgtcggctaaattaaccgccgcatcaaggtcatttcctctaatccactcttggagtggttgttgacctagttgc |
25495345 |
T |
|
| Q |
216 |
ttttttggatttgatattgcatcaccttgtttgcgcggagttccttgcaaggcttgtttggaattagctactgctggacgagtttttccattagctttca |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25495346 |
ttttttggatttgatattgcatcaccttgtttgcgcggagttccttgcaaggcttgtttggaattagctactgctggacgagtttttccattagctttca |
25495445 |
T |
|
| Q |
316 |
ctgaagcgtcttctcttgaattttcgaggactaaaattggtttacttccaagaacactcttttgattttgagaactacttgtagttgaaacaggaagctt |
415 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25495446 |
ttgaagcgtcttctcttgaattttcgaggactaaaattggtttacttccaagaacactcttttgattttgagaactacttgtagttgaaacaggaagctt |
25495545 |
T |
|
| Q |
416 |
ggacgattgaggctctcggttataaacagaaaaggatgataggttggtggataaggcagcttggacccaagaagctgcaagtttttgtctatctgatttg |
515 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25495546 |
ggacgattgaggctctcggttataaacagaaaaggatgataggttggtggataaggcagcttggacccaagaagctgcaagtttttgtctatctgatttg |
25495645 |
T |
|
| Q |
516 |
agtttctctgctccttc |
532 |
Q |
| |
|
||||||| |||| |||| |
|
|
| T |
25495646 |
agtttctgtgcttcttc |
25495662 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 1 - 62
Target Start/End: Original strand, 25495131 - 25495192
Alignment:
| Q |
1 |
catccaaccaatcgttgactctttttagttgagtgagaatgcttgctttttgcccattgttt |
62 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||| |||| |||| ||||||||| |
|
|
| T |
25495131 |
catccaaccaatcgttgacgctttttagttgagtgagaatgcctgctatttgaccattgttt |
25495192 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University