View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11236_high_18 (Length: 287)
Name: NF11236_high_18
Description: NF11236
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11236_high_18 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 1 - 268
Target Start/End: Original strand, 46937992 - 46938259
Alignment:
| Q |
1 |
atcccaaaggagaaagggcagatggatgatgcagtggctggaaggatagttgaaccagctgctgcgaagttacaacctttcctaaaatttggcaaaccca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46937992 |
atcccaaaggagaaagggcagatggatgatgcagtggctggaaggatagttgaaccagctgctgcgaagttacaacctttcctaaaatttggcaaaccca |
46938091 |
T |
|
| Q |
101 |
atgaatccaaatatgcatttaagaatggtaaatccaatgcatccactgaaaacaacatccaagacaacatcattaggaagacgaaagaaagnnnnnnnnt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| | |
|
|
| T |
46938092 |
atgaatccaaatatgcatttaagaatggtaaatccaatgcatccactgaaaacaacatccaagacaatatcattaggaagacgaaagaaagaaaaaaaat |
46938191 |
T |
|
| Q |
201 |
ccacactttttaatttatggagatttagttgttactaagaaaatcaatgatgagccggccatcagagt |
268 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46938192 |
ccacactttttaatttatggagatttagttgttactaagaaaatcaatgatgagccggccatcagagt |
46938259 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 37 - 148
Target Start/End: Complemental strand, 36634084 - 36633973
Alignment:
| Q |
37 |
gctggaaggatagttgaaccagctgctgcgaagttacaacctttcctaaaatttggcaaacccaatgaatccaaatatgcatttaagaatggtaaatcca |
136 |
Q |
| |
|
|||||||||||||||||||| |||||||| ||||| || || | ||||||||| | |||| |||||||| ||| |||||||||||||| || |||| |
|
|
| T |
36634084 |
gctggaaggatagttgaacctgctgctgcaaagttgcatccgtgatggaaatttggcgagcccactgaatccagataggcatttaagaatggcaagtcca |
36633985 |
T |
|
| Q |
137 |
atgcatccactg |
148 |
Q |
| |
|
||||||||||| |
|
|
| T |
36633984 |
ttgcatccactg |
36633973 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University